t7 promoter Search Results


94
Danaher Inc t7 promoter
T7 Promoter, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+promoter/pmc06021189-127-9-19?v=Danaher+Inc
Average 94 stars, based on 1 article reviews
t7 promoter - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
Addgene inc t7 promoter
T7 Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+promoter/pm36753880-522-6-10?v=Addgene+inc
Average 94 stars, based on 1 article reviews
t7 promoter - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

93
Addgene inc dual t7 promoter system
Dual T7 Promoter System, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+promoter/pm33408643-283-16-33?v=Addgene+inc
Average 93 stars, based on 1 article reviews
dual t7 promoter system - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

92
Addgene inc plasmid encoding t7 promoter
( A ) V976L mutation emerged in 190366 virus stocks. ( B ) Pseudotyped particles were produced with full-length spike WT or the V967L mutant. Spike was detected in producer cells and pseudotyped by western blotting for FLAG. ( C ) Indicated cells were infected with viral pseudotyped in the presence or absence of trypsin. ( D ) Schematic overview of the dual-reporter fusion assay developed for this study. <t>T7</t> polymerase drives expression <t>of</t> <t>GFP</t> and luciferase separated by a P2A fusion peptide. ( E ) HEK 293T cells expressing receptor or, ( F) empty vector and T7-polymerase were combined with cells expressing spike and the T7-driven reporter. Luciferase was measured as a readout for cell fusion. Dotted lines indicate data from 1:4 ratio of receptor:spike cells. ( G ) Overview of 190366 spike with in silico predicted trypsin digest sites indicated. Location of V976L is indicated in green. ( H ) Concentrated viral pseudotyped were combined with a wide range or trypsin dilutions or ( I ) a fine range of trypsin dilutions and incubated at 37°C. Spike digestion was assessed by western blot for FLAG epitope.
Plasmid Encoding T7 Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+promoter/bio_rxiv__2023__03__02__530738-123-0-34?v=Addgene+inc
Average 92 stars, based on 1 article reviews
plasmid encoding t7 promoter - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

90
NZYTech Inc pcr products containing t7 promoter sequence
( A ) V976L mutation emerged in 190366 virus stocks. ( B ) Pseudotyped particles were produced with full-length spike WT or the V967L mutant. Spike was detected in producer cells and pseudotyped by western blotting for FLAG. ( C ) Indicated cells were infected with viral pseudotyped in the presence or absence of trypsin. ( D ) Schematic overview of the dual-reporter fusion assay developed for this study. <t>T7</t> polymerase drives expression <t>of</t> <t>GFP</t> and luciferase separated by a P2A fusion peptide. ( E ) HEK 293T cells expressing receptor or, ( F) empty vector and T7-polymerase were combined with cells expressing spike and the T7-driven reporter. Luciferase was measured as a readout for cell fusion. Dotted lines indicate data from 1:4 ratio of receptor:spike cells. ( G ) Overview of 190366 spike with in silico predicted trypsin digest sites indicated. Location of V976L is indicated in green. ( H ) Concentrated viral pseudotyped were combined with a wide range or trypsin dilutions or ( I ) a fine range of trypsin dilutions and incubated at 37°C. Spike digestion was assessed by western blot for FLAG epitope.
Pcr Products Containing T7 Promoter Sequence, supplied by NZYTech Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+promoter/pmc05095591-224-22-28?v=NZYTech+Inc
Average 90 stars, based on 1 article reviews
pcr products containing t7 promoter sequence - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
AstraZeneca ltd parc8241 kmr, b under t7 promoter in pet11dkm (apr is replaced by kmr in pet11d)
( A ) V976L mutation emerged in 190366 virus stocks. ( B ) Pseudotyped particles were produced with full-length spike WT or the V967L mutant. Spike was detected in producer cells and pseudotyped by western blotting for FLAG. ( C ) Indicated cells were infected with viral pseudotyped in the presence or absence of trypsin. ( D ) Schematic overview of the dual-reporter fusion assay developed for this study. <t>T7</t> polymerase drives expression <t>of</t> <t>GFP</t> and luciferase separated by a P2A fusion peptide. ( E ) HEK 293T cells expressing receptor or, ( F) empty vector and T7-polymerase were combined with cells expressing spike and the T7-driven reporter. Luciferase was measured as a readout for cell fusion. Dotted lines indicate data from 1:4 ratio of receptor:spike cells. ( G ) Overview of 190366 spike with in silico predicted trypsin digest sites indicated. Location of V976L is indicated in green. ( H ) Concentrated viral pseudotyped were combined with a wide range or trypsin dilutions or ( I ) a fine range of trypsin dilutions and incubated at 37°C. Spike digestion was assessed by western blot for FLAG epitope.
Parc8241 Kmr, B Under T7 Promoter In Pet11dkm (Apr Is Replaced By Kmr In Pet11d), supplied by AstraZeneca ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+promoter/pm21435034-246-212-228?v=AstraZeneca+ltd
Average 90 stars, based on 1 article reviews
parc8241 kmr, b under t7 promoter in pet11dkm (apr is replaced by kmr in pet11d) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation dsdna sequences attached t7 promoter
( A ) V976L mutation emerged in 190366 virus stocks. ( B ) Pseudotyped particles were produced with full-length spike WT or the V967L mutant. Spike was detected in producer cells and pseudotyped by western blotting for FLAG. ( C ) Indicated cells were infected with viral pseudotyped in the presence or absence of trypsin. ( D ) Schematic overview of the dual-reporter fusion assay developed for this study. <t>T7</t> polymerase drives expression <t>of</t> <t>GFP</t> and luciferase separated by a P2A fusion peptide. ( E ) HEK 293T cells expressing receptor or, ( F) empty vector and T7-polymerase were combined with cells expressing spike and the T7-driven reporter. Luciferase was measured as a readout for cell fusion. Dotted lines indicate data from 1:4 ratio of receptor:spike cells. ( G ) Overview of 190366 spike with in silico predicted trypsin digest sites indicated. Location of V976L is indicated in green. ( H ) Concentrated viral pseudotyped were combined with a wide range or trypsin dilutions or ( I ) a fine range of trypsin dilutions and incubated at 37°C. Spike digestion was assessed by western blot for FLAG epitope.
Dsdna Sequences Attached T7 Promoter, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+promoter/pm39325749-90-21-24?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
dsdna sequences attached t7 promoter - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Telesis Bio Inc bacmids encoding the t7 promoter driven full length genome of delta wild type
( A ) V976L mutation emerged in 190366 virus stocks. ( B ) Pseudotyped particles were produced with full-length spike WT or the V967L mutant. Spike was detected in producer cells and pseudotyped by western blotting for FLAG. ( C ) Indicated cells were infected with viral pseudotyped in the presence or absence of trypsin. ( D ) Schematic overview of the dual-reporter fusion assay developed for this study. <t>T7</t> polymerase drives expression <t>of</t> <t>GFP</t> and luciferase separated by a P2A fusion peptide. ( E ) HEK 293T cells expressing receptor or, ( F) empty vector and T7-polymerase were combined with cells expressing spike and the T7-driven reporter. Luciferase was measured as a readout for cell fusion. Dotted lines indicate data from 1:4 ratio of receptor:spike cells. ( G ) Overview of 190366 spike with in silico predicted trypsin digest sites indicated. Location of V976L is indicated in green. ( H ) Concentrated viral pseudotyped were combined with a wide range or trypsin dilutions or ( I ) a fine range of trypsin dilutions and incubated at 37°C. Spike digestion was assessed by western blot for FLAG epitope.
Bacmids Encoding The T7 Promoter Driven Full Length Genome Of Delta Wild Type, supplied by Telesis Bio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+promoter/pm37271493-127-1-31?v=Telesis+Bio+Inc
Average 90 stars, based on 1 article reviews
bacmids encoding the t7 promoter driven full length genome of delta wild type - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
MWG-Biotech ag t7 promoter primer
( A ) V976L mutation emerged in 190366 virus stocks. ( B ) Pseudotyped particles were produced with full-length spike WT or the V967L mutant. Spike was detected in producer cells and pseudotyped by western blotting for FLAG. ( C ) Indicated cells were infected with viral pseudotyped in the presence or absence of trypsin. ( D ) Schematic overview of the dual-reporter fusion assay developed for this study. <t>T7</t> polymerase drives expression <t>of</t> <t>GFP</t> and luciferase separated by a P2A fusion peptide. ( E ) HEK 293T cells expressing receptor or, ( F) empty vector and T7-polymerase were combined with cells expressing spike and the T7-driven reporter. Luciferase was measured as a readout for cell fusion. Dotted lines indicate data from 1:4 ratio of receptor:spike cells. ( G ) Overview of 190366 spike with in silico predicted trypsin digest sites indicated. Location of V976L is indicated in green. ( H ) Concentrated viral pseudotyped were combined with a wide range or trypsin dilutions or ( I ) a fine range of trypsin dilutions and incubated at 37°C. Spike digestion was assessed by western blot for FLAG epitope.
T7 Promoter Primer, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+promoter/pmc03232396-52-28-31?v=MWG-Biotech+ag
Average 90 stars, based on 1 article reviews
t7 promoter primer - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Promega t7 promoter primer (taatacgactcactataggg)
( A ) V976L mutation emerged in 190366 virus stocks. ( B ) Pseudotyped particles were produced with full-length spike WT or the V967L mutant. Spike was detected in producer cells and pseudotyped by western blotting for FLAG. ( C ) Indicated cells were infected with viral pseudotyped in the presence or absence of trypsin. ( D ) Schematic overview of the dual-reporter fusion assay developed for this study. <t>T7</t> polymerase drives expression <t>of</t> <t>GFP</t> and luciferase separated by a P2A fusion peptide. ( E ) HEK 293T cells expressing receptor or, ( F) empty vector and T7-polymerase were combined with cells expressing spike and the T7-driven reporter. Luciferase was measured as a readout for cell fusion. Dotted lines indicate data from 1:4 ratio of receptor:spike cells. ( G ) Overview of 190366 spike with in silico predicted trypsin digest sites indicated. Location of V976L is indicated in green. ( H ) Concentrated viral pseudotyped were combined with a wide range or trypsin dilutions or ( I ) a fine range of trypsin dilutions and incubated at 37°C. Spike digestion was assessed by western blot for FLAG epitope.
T7 Promoter Primer (Taatacgactcactataggg), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+promoter/us09574242-208-29-28?v=Promega
Average 90 stars, based on 1 article reviews
t7 promoter primer (taatacgactcactataggg) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Promega t7 promoter-fused cdna
( A ) V976L mutation emerged in 190366 virus stocks. ( B ) Pseudotyped particles were produced with full-length spike WT or the V967L mutant. Spike was detected in producer cells and pseudotyped by western blotting for FLAG. ( C ) Indicated cells were infected with viral pseudotyped in the presence or absence of trypsin. ( D ) Schematic overview of the dual-reporter fusion assay developed for this study. <t>T7</t> polymerase drives expression <t>of</t> <t>GFP</t> and luciferase separated by a P2A fusion peptide. ( E ) HEK 293T cells expressing receptor or, ( F) empty vector and T7-polymerase were combined with cells expressing spike and the T7-driven reporter. Luciferase was measured as a readout for cell fusion. Dotted lines indicate data from 1:4 ratio of receptor:spike cells. ( G ) Overview of 190366 spike with in silico predicted trypsin digest sites indicated. Location of V976L is indicated in green. ( H ) Concentrated viral pseudotyped were combined with a wide range or trypsin dilutions or ( I ) a fine range of trypsin dilutions and incubated at 37°C. Spike digestion was assessed by western blot for FLAG epitope.
T7 Promoter Fused Cdna, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+promoter/10__1074_slash_jbc__m413564200-81-5-13?v=Promega
Average 90 stars, based on 1 article reviews
t7 promoter-fused cdna - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


( A ) V976L mutation emerged in 190366 virus stocks. ( B ) Pseudotyped particles were produced with full-length spike WT or the V967L mutant. Spike was detected in producer cells and pseudotyped by western blotting for FLAG. ( C ) Indicated cells were infected with viral pseudotyped in the presence or absence of trypsin. ( D ) Schematic overview of the dual-reporter fusion assay developed for this study. T7 polymerase drives expression of GFP and luciferase separated by a P2A fusion peptide. ( E ) HEK 293T cells expressing receptor or, ( F) empty vector and T7-polymerase were combined with cells expressing spike and the T7-driven reporter. Luciferase was measured as a readout for cell fusion. Dotted lines indicate data from 1:4 ratio of receptor:spike cells. ( G ) Overview of 190366 spike with in silico predicted trypsin digest sites indicated. Location of V976L is indicated in green. ( H ) Concentrated viral pseudotyped were combined with a wide range or trypsin dilutions or ( I ) a fine range of trypsin dilutions and incubated at 37°C. Spike digestion was assessed by western blot for FLAG epitope.

Journal: bioRxiv

Article Title: Isolation of ACE2-dependent and -independent sarbecoviruses from Chinese horseshoe bats

doi: 10.1101/2023.03.02.530738

Figure Lengend Snippet: ( A ) V976L mutation emerged in 190366 virus stocks. ( B ) Pseudotyped particles were produced with full-length spike WT or the V967L mutant. Spike was detected in producer cells and pseudotyped by western blotting for FLAG. ( C ) Indicated cells were infected with viral pseudotyped in the presence or absence of trypsin. ( D ) Schematic overview of the dual-reporter fusion assay developed for this study. T7 polymerase drives expression of GFP and luciferase separated by a P2A fusion peptide. ( E ) HEK 293T cells expressing receptor or, ( F) empty vector and T7-polymerase were combined with cells expressing spike and the T7-driven reporter. Luciferase was measured as a readout for cell fusion. Dotted lines indicate data from 1:4 ratio of receptor:spike cells. ( G ) Overview of 190366 spike with in silico predicted trypsin digest sites indicated. Location of V976L is indicated in green. ( H ) Concentrated viral pseudotyped were combined with a wide range or trypsin dilutions or ( I ) a fine range of trypsin dilutions and incubated at 37°C. Spike digestion was assessed by western blot for FLAG epitope.

Article Snippet: Plasmid encoding T7-promoter driven dual reporter GFP and luciferase was generated by cloning firefly luciferase downstream of GFP in pUC19-T7-IRES-GFP. pUC19 - T7 pro - IRES - EGFP was a gift from Fei Chen (Addgene plasmid # 138586; http://n2t.net/addgene:138586 ; RRID: Addgene_138586).

Techniques: Mutagenesis, Produced, Western Blot, Infection, Single Vesicle Fusion Assay, Expressing, Luciferase, Plasmid Preparation, In Silico, Incubation, FLAG-tag